View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_high_61 (Length: 374)
Name: NF11788_high_61
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 333; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 14 - 358
Target Start/End: Original strand, 12616157 - 12616501
Alignment:
| Q |
14 |
agggattaccaggtgcaactagtttcttttgttccattggttttgcaaagaaatcaaaacctacttcttccattttggatatgatgtcataagggacacc |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12616157 |
agggattaccaagtgcaactagtttcttttgttccattggttttgcaaagaaatcaaaacctacttcttccattttggatatgatgtcatgagggacacc |
12616256 |
T |
|
| Q |
114 |
atggttaatcacattgaagaaaccatattcttcacaagcttttactatgagttttattaccattgatttttcagctgataggtctatcattggtaggtca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616257 |
atggttaatcacattgaagaaaccatattcttcacaagcttttactatgagttttattaccattgatttttcagctgataggtctatcattggtaggtca |
12616356 |
T |
|
| Q |
214 |
ataggtataatcctttcccctaagatcgaatttggggaagccaccaccatgttaattttcttctaagaaaataaagtgaaagggtatacaaagtgtttag |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12616357 |
ataggtataatcctttcccctaagatcgaatttggggaagccaccaccatgttaattttcttctaagaaaataaagtgaaagggtatacaaagcgtttag |
12616456 |
T |
|
| Q |
314 |
aaagaagacaaaatatgggtttgagataggttattgtgttggtaa |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616457 |
aaagaagacaaaatatgggtttgagataggttattgtgttggtaa |
12616501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 112 - 164
Target Start/End: Original strand, 29878072 - 29878124
Alignment:
| Q |
112 |
ccatggttaatcacattgaagaaaccatattcttcacaagcttttactatgag |
164 |
Q |
| |
|
|||||||| || || |||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
29878072 |
ccatggtttatgactttgaagaatccaaaatcttcacaagcttttactatgag |
29878124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University