View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_high_73 (Length: 341)
Name: NF11788_high_73
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_high_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 92 - 326
Target Start/End: Original strand, 32190452 - 32190686
Alignment:
| Q |
92 |
ctgaaatagccctaaggcacatattctgggatagaatggataagaaggagcgatagttaaggtctgacgcaagcggtgtttcaagtttcaagggacacac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32190452 |
ctgaaatagccctaaggcacatattctgggatagaatggataagaaggagcgatagttaaggtctgacgcaagcggtgtttcaagtttcaacggacacac |
32190551 |
T |
|
| Q |
192 |
gtattccccacttatttgtatgtcttaattgataacgtgacccacattatcttcaaccacacagcttacatagatatttctctctcataaatcatcacca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190552 |
gtattccccacttatttgtatgtcttaattgataacgtgacccacattatcttcaaccacacagcttacatagatatttctctctcataaatcatcacca |
32190651 |
T |
|
| Q |
292 |
agatcatagataaataattgaacaacattgttcat |
326 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32190652 |
agatcatagataaataattgaacaacactgttcat |
32190686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 41 - 74
Target Start/End: Original strand, 32190401 - 32190434
Alignment:
| Q |
41 |
gtaggtgaattctaacaaccatatactacttatg |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32190401 |
gtaggtgaattctaacaaccatatactacttatg |
32190434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University