View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_high_74 (Length: 338)
Name: NF11788_high_74
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_high_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 86 - 327
Target Start/End: Original strand, 48752288 - 48752540
Alignment:
| Q |
86 |
aaaataaaaattaaggtttagggttttggaaatcgtcttctagaatgattcgcgttagacttctttcatctcatt-----------aacccggtgctacc |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
48752288 |
aaaaaaaaaattaaggtttagggttttggaaatcgtcttctagaatgattcgcgttagacttcttttatctcattctcatcgcattaacccggtgctacc |
48752387 |
T |
|
| Q |
175 |
aaatacatcaattcgtgtctcaggtattaattactttacttttttcagtaacgaacatttcccgaatatgcttgattattgacttttattttcccctttc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48752388 |
aaatacatcaattcgtgtctcaggtattaattactttacttttttcagtaacgaacatttcccgaatatgcttgattattgacttttattttcccctttc |
48752487 |
T |
|
| Q |
275 |
agcatcactgtcaacataccacaattatgaaagagatccatcttcttcatctc |
327 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48752488 |
agcatcactgtcaagataccacaattatgaaagagatccatcttcttcttctc |
48752540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 48752015 - 48752080
Alignment:
| Q |
19 |
aaaattgcagtatgatgtgtcaaaattatgagtactgattggttaagacatttatttgcttgaaaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
48752015 |
aaaattgcagtatgatgtgtcaaaattatgagtactgattggttcagacatttatttgcttaaaaa |
48752080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 254 - 286
Target Start/End: Complemental strand, 40734038 - 40734006
Alignment:
| Q |
254 |
tgacttttattttcccctttcagcatcactgtc |
286 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
40734038 |
tgactttaattttcccctttcagcatcactgtc |
40734006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 228 - 327
Target Start/End: Complemental strand, 52083974 - 52083875
Alignment:
| Q |
228 |
aacatttcccgaatatgcttgattattgacttttattttcccctttcagcatcactgtcaacataccacaattatgaaagagatccatcttcttcatctc |
327 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
52083974 |
aacatttcccatatatgcttgattattgacctttattttcccctttcagcatcactgtcaagataccacatttatgaaagttatccatcttcttcttctc |
52083875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 228 - 327
Target Start/End: Complemental strand, 52093337 - 52093238
Alignment:
| Q |
228 |
aacatttcccgaatatgcttgattattgacttttattttcccctttcagcatcactgtcaacataccacaattatgaaagagatccatcttcttcatctc |
327 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
52093337 |
aacatttcccatatatgcttgattattgacctttattttcccctttcagcatcactgtcaagataccacatttatgaaagttatccatcttcttcttctc |
52093238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University