View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_high_75 (Length: 336)
Name: NF11788_high_75
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_high_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 119 - 318
Target Start/End: Original strand, 2748682 - 2748882
Alignment:
| Q |
119 |
taggtcattattataaataaccttctttaattttctgtagggcttgataaagtggtttttggcttttcttcttaagaaagttgccaagacaatgaagaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748682 |
taggtcattattataaataaccttctttaattttctgtagggcttgataaagtggtttttggtttttcttcttaagaaagttgccaagacaatgaagaga |
2748781 |
T |
 |
| Q |
219 |
acgttcagcggcgaatgaaactgcga-cgatgacgctgcaaacaagggcaacaatccatgtaggagcatattgcaaatcgggtccttcttcaacttgtcc |
317 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748782 |
acattcagcggcgaatgaaactgcgaccgatgacgctgcaaacaagggcaacaatccatgtaggagcatattgcaaatcgggtccttcttcaacttgtcc |
2748881 |
T |
 |
| Q |
318 |
t |
318 |
Q |
| |
|
| |
|
|
| T |
2748882 |
t |
2748882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 137 - 318
Target Start/End: Original strand, 2756765 - 2756946
Alignment:
| Q |
137 |
aaccttctttaattttctgtagggcttgataaagtggtttttggcttttcttcttaagaaagttgccaagacaatgaagagaacgttcagcggcgaatga |
236 |
Q |
| |
|
|||||||||| ||||| |||| ||||| | | |||||||| || ||||||||||||||| ||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
2756765 |
aaccttctttgattttttgtaaggcttcaaagagtggtttctgatttttcttcttaagaaccttgccaagataatgaagagaacgttccaccgcgaatga |
2756864 |
T |
 |
| Q |
237 |
aactgcgacgatgacgctgcaaacaagggcaacaatccatgtaggagcatattgcaaatcgggtccttcttcaacttgtcct |
318 |
Q |
| |
|
||| ||||||||||| |||||||||| ||||||| ||||||||| | | |||||||||| |||||||||| ||| |||| |
|
|
| T |
2756865 |
aacagcgacgatgacagtgcaaacaagagcaacaacccatgtaggtgtaaattgcaaatctcttccttcttcagcttctcct |
2756946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University