View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_high_85 (Length: 316)
Name: NF11788_high_85
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_high_85 |
 |  |
|
| [»] scaffold0271 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 9e-70; HSPs: 18)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 48930341 - 48930191
Alignment:
| Q |
19 |
ctcattgcagtgaccatagtgccatgcatgcaacacagacaaatgctataaaagaacattctttaattccaatgcagtcacggaacaatcaggataagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48930341 |
ctcattgcagtgaccatagtgccatgca----acacagacaaatgctataaaagaacattctttaattccaatgcagtcacggaacaatcaggataagtt |
48930246 |
T |
 |
| Q |
119 |
gagggttttcactttctgcaccgacaaaaatgtaaaactggtaaagatgtgtgtg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48930245 |
gagggttttcactttctgcaccgacaaaaatgtaatactggtaaagatgtgtgtg |
48930191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 210 - 252
Target Start/End: Complemental strand, 48930137 - 48930095
Alignment:
| Q |
210 |
acacaaaattaaacttcattcaaatgataaaataaggatagta |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48930137 |
acacaaaattaaacttcattcaaatgataaaataaggatagta |
48930095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 21919685 - 21919733
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
21919685 |
atagggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
21919733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 31743711 - 31743663
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
31743711 |
atagggaacttctacggtacacctcacaaattgtggtgtaccggtactc |
31743663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 29688923 - 29688969
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
29688923 |
agggaacttctacggtacacctcataaattgaggtgtaccggtactc |
29688969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 212 - 254
Target Start/End: Complemental strand, 40246804 - 40246762
Alignment:
| Q |
212 |
acaaaattaaacttcattcaaatgataaaataaggatagtaca |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
40246804 |
acaaaattaaacttcattcaaatgataaaataaagatactaca |
40246762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 5215431 - 5215386
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
5215431 |
gggaacttctacggtacacatcacaaattgaggtgtaccggtactc |
5215386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 27567157 - 27567206
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
27567157 |
atagggaacttttacggtacacctcacaaatttaggtgtaccggtactct |
27567206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 303
Target Start/End: Original strand, 38882812 - 38882864
Alignment:
| Q |
251 |
tacatagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| || | |||||||||||||| |
|
|
| T |
38882812 |
tacaaagggaacttctacggtacacctaacaaaatgaggtgtaccggtactct |
38882864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 1343428 - 1343382
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||| |||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
1343428 |
aggggacttctacggtacaccacataaattgagatgtaccggtactc |
1343382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 304
Target Start/End: Original strand, 27800033 - 27800075
Alignment:
| Q |
262 |
cttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
27800033 |
cttctacggtacacctcataaattgaggtgtaccggtactctc |
27800075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 286
Target Start/End: Complemental strand, 42584169 - 42584139
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42584169 |
agggaacttctacggtacacctcacaaattg |
42584139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 23182390 - 23182435
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
23182390 |
gggaacttctacggtacacctcacaaattaaggtgtactggtactc |
23182435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 24204611 - 24204660
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||| ||||||| | ||| || |||||||||||||||| |
|
|
| T |
24204611 |
atagggaacttctacgatacacctaataaaatgagatgtaccggtactct |
24204660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 304
Target Start/End: Original strand, 40856544 - 40856585
Alignment:
| Q |
263 |
ttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
40856544 |
ttctacggtacacctcacaaattgaggtgtaccgatactctc |
40856585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 48460251 - 48460296
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||| |||||||||||||||||| | | ||||||||||| |
|
|
| T |
48460251 |
gggaacttctatggtacacctcacaaattgaggtataccggtactc |
48460296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 301
Target Start/End: Original strand, 22639367 - 22639411
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
22639367 |
gggagcttctacggtacacctcacaaattgaggtgtaccgatact |
22639411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 26605054 - 26605101
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
26605054 |
tagggaacttctacggtaca-ctcacaaaatgaggtgtaccggtactct |
26605101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 13)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 23870267 - 23870313
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23870267 |
agggaacttctacggtacacctcacaaattggggtgtaccggtactc |
23870313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 9508855 - 9508902
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
9508855 |
tagggaacttctacggtacacctcacaaattagggtgtaccggtactc |
9508902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 41592 - 41637
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41592 |
gggaatttctacggtacacctcacaaattggggtgtaccggtactc |
41637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 255 - 296
Target Start/End: Original strand, 5215320 - 5215361
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5215320 |
tagggaacttctacggtacacctcacaaattgagatgtaccg |
5215361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 12632903 - 12632949
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
12632903 |
agggaacttctacggtacacctcacaaattgaggtgtaccgatactc |
12632949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 258 - 304
Target Start/End: Complemental strand, 28886087 - 28886041
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
28886087 |
ggaacttctacggtacacctcacaaattgaggtgtaccgatactctc |
28886041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 32887663 - 32887711
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| | ||||||||||||| |
|
|
| T |
32887663 |
atagggaacttctacggtacatctcataaattgaggtgtaccggtactc |
32887711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 304
Target Start/End: Complemental strand, 12801507 - 12801465
Alignment:
| Q |
262 |
cttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
12801507 |
cttctacggtacacctcataaattgaggtgtaccggtactctc |
12801465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 38764737 - 38764783
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||| |||||||| |
|
|
| T |
38764737 |
agggaacttctacggtacaccttacaaattgaggtgtatcggtactc |
38764783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 31893333 - 31893378
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||| |||||||||||||||| | ||||||| ||||| |
|
|
| T |
31893333 |
gggaacttctacgttacacctcacaaattgaggtgtaccgatactc |
31893378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 41423742 - 41423702
Alignment:
| Q |
262 |
cttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
41423742 |
cttctgcggtatacctcacaaattggggtgtaccggtactc |
41423702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 43332144 - 43332104
Alignment:
| Q |
263 |
ttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
43332144 |
ttctacggtacacctcacaaattgaggtgtaccgatactct |
43332104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 44309966 - 44309926
Alignment:
| Q |
263 |
ttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
44309966 |
ttctacggtacacctcacaaattgaggtgtaccgatactct |
44309926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 7080518 - 7080472
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7080518 |
agggaacttctacggtacacctcacaaattggggtgtaccggtactc |
7080472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 39939032 - 39939078
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39939032 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
39939078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 5512682 - 5512727
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5512682 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
5512727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 34901657 - 34901702
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
34901657 |
gggaacttctacggtacacctcataaattggggtgtaccggtactc |
34901702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 301
Target Start/End: Original strand, 40524083 - 40524128
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
40524083 |
agggaacttctacggtacacctcacaaattggggtgtactggtact |
40524128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 5204614 - 5204662
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
5204614 |
atagggaacttctacggtacacctcacaaattgaggtgtatcggtactc |
5204662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 257 - 301
Target Start/End: Complemental strand, 31588641 - 31588597
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
31588641 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtact |
31588597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 40756538 - 40756586
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
40756538 |
atagggaacttctacggtacacctcacaaattgaggtgtatcggtactc |
40756586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 5140667 - 5140714
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
5140667 |
taggaaacttctacggtacacctcacaaattgaggtgtaccggtactc |
5140714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 4039469 - 4039515
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
4039469 |
gggaacttctacggtacacctcacaaattaaggtgtaccggtactct |
4039515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 310
Target Start/End: Complemental strand, 39979751 - 39979698
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactctctgcttc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||| |||| |||||||| |
|
|
| T |
39979751 |
agggaacttctacggtacacctcacaaattgaggtgtaccgatact-tctgcttc |
39979698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 254 - 299
Target Start/End: Original strand, 23690498 - 23690543
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggta |
299 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | |||||||||| |
|
|
| T |
23690498 |
atagggaacttctacggtacacctcaaaaattgaggtgtaccggta |
23690543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 286
Target Start/End: Complemental strand, 4429827 - 4429797
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4429827 |
agggaacttctacggtacacctcacaaattg |
4429797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 6335797 - 6335751
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
6335797 |
gggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
6335751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 13593281 - 13593327
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
13593281 |
gggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
13593327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 16602360 - 16602406
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||| || |||||| |
|
|
| T |
16602360 |
gggagcttctacggtacacctcacaaattgagatgtaacgatactct |
16602406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 283
Target Start/End: Complemental strand, 4367197 - 4367169
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4367197 |
tagggaacttctacggtacacctcacaaa |
4367169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 12336615 - 12336575
Alignment:
| Q |
263 |
ttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
12336615 |
ttctacggtacacctcacaaattgaggtgtaccgatactct |
12336575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 25)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 22789581 - 22789627
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22789581 |
agggaacttctacggtacacctcacaaattggggtgtaccggtactc |
22789627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 256 - 304
Target Start/End: Original strand, 27950257 - 27950305
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
27950257 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactctc |
27950305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 21722600 - 21722554
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
21722600 |
agggaacttctacggtacacctcacaaattggggtgtaccgatactc |
21722554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 32570774 - 32570728
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
32570774 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactct |
32570728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 19527130 - 19527085
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
19527130 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
19527085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 4491265 - 4491217
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
4491265 |
atagggaacttctacggtacacctcataaattgaggtgtaccggtactc |
4491217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 261 - 304
Target Start/End: Original strand, 25607694 - 25607737
Alignment:
| Q |
261 |
acttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
25607694 |
acttctacggtacacctcacaaattgaggtgtaccggtactctc |
25607737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 259 - 302
Target Start/End: Original strand, 39103539 - 39103582
Alignment:
| Q |
259 |
gaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39103539 |
gaacttctacggtacacctcacaaattgaggtgtaccggtactc |
39103582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 302
Target Start/End: Original strand, 49286686 - 49286733
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
49286686 |
tagggagcttctacggtacacctcacaaattgaggtgtaccggtactc |
49286733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 34584181 - 34584227
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
34584181 |
agggaacttctacggtacacctcacaaattgaggtgtaccgatactc |
34584227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 595296 - 595341
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
595296 |
gggaatttctacggtacacctcacaaattgaggtgtaccggtactc |
595341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 299
Target Start/End: Complemental strand, 12756408 - 12756367
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattgggatgtaccggta |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
12756408 |
ggaacttctacggtacacctcacaaattgaggtgtaccggta |
12756367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 21424549 - 21424502
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||| || ||||| || |||||||||||||||| |
|
|
| T |
21424549 |
agggaacttctacggtacatctaacaaaatgagatgtaccggtactct |
21424502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 23058765 - 23058811
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
||||||||||||||||||| ||||||| || ||||||||||||||||| |
|
|
| T |
23058765 |
gggaacttctacggtacac-tcacaaagtgagatgtaccggtactctc |
23058811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 48207485 - 48207438
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
48207485 |
agggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
48207438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 54178827 - 54178780
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
54178827 |
agggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
54178780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 24566367 - 24566413
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||| ||||| || | |||||||||||||| |
|
|
| T |
24566367 |
gggaacttctacggtacacctaacaaaatgaggtgtaccggtactct |
24566413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 286
Target Start/End: Original strand, 34927101 - 34927131
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34927101 |
agggaacttctacggtacacctcacaaattg |
34927131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 286
Target Start/End: Original strand, 1605590 - 1605619
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1605590 |
gggaacttctacggtacacctcacaaattg |
1605619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 286
Target Start/End: Complemental strand, 3690919 - 3690890
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3690919 |
gggaacttctacggtacacctcacaaattg |
3690890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 31296530 - 31296575
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
31296530 |
gggaacttttacgggacacctcacaaattgaggtgtaccggtactc |
31296575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 286
Target Start/End: Original strand, 43349052 - 43349081
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43349052 |
gggaacttctacggtacacctcacaaattg |
43349081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 52323966 - 52324011
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||| ||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
52323966 |
gggaacttctgcggtacacctcacaaattgaggtgtaccgatactc |
52324011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 302
Target Start/End: Original strand, 53973464 - 53973501
Alignment:
| Q |
265 |
ctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
53973464 |
ctacggtacacctcacaaattgaggtgtaccggtactc |
53973501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 301
Target Start/End: Complemental strand, 29582372 - 29582329
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
29582372 |
gggaacttctacggtaca-ctcacaaattgaggtgtaccggtact |
29582329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 52058514 - 52058559
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52058514 |
gggaacttctacggtacacctcacaaattggggtgtaccggtactc |
52058559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 302
Target Start/End: Original strand, 41982391 - 41982435
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41982391 |
ggaacttctacggtacacctcacaaattggggtgtaccggtactc |
41982435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 48795438 - 48795485
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
48795438 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactct |
48795485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 29698322 - 29698367
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
29698322 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
29698367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 14998147 - 14998194
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| |||||||||| |
|
|
| T |
14998147 |
gggaacttctacggtacacctcacaaattgtggtgtatcggtactctc |
14998194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 35375511 - 35375557
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
35375511 |
gggaacttctacggtacacctcacaaattgaggtgtatcggtactct |
35375557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 32121899 - 32121944
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||| || | ||||||||||||| |
|
|
| T |
32121899 |
gggaacttctacggtacacctcacaaagtgaggtgtaccggtactc |
32121944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 43903479 - 43903434
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
43903479 |
gggaacttctacggtacacctcacaaattgaggtgtatcggtactc |
43903434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 45633571 - 45633526
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45633571 |
gggaacttctgcggtacaccttacaaattggggtgtaccggtactc |
45633526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 4521268 - 4521315
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
4521268 |
agggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
4521315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 20199755 - 20199708
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
20199755 |
agggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
20199708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 296
Target Start/End: Complemental strand, 29815535 - 29815496
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
29815535 |
gggaacttctacggtacacctcacaaattgaggtgtaccg |
29815496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 29385090 - 29385044
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
29385090 |
agggaatttctacggtacacctcacaaattgaggtgtaccgatactc |
29385044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 5640065 - 5640020
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
5640065 |
gggaacttatacgatacacctcaccaattggggtgtaccggtactc |
5640020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 303
Target Start/End: Original strand, 37520699 - 37520747
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
37520699 |
atagggaacttctacggtaca-ctcacaaaatgaggtgtaccggtactct |
37520747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 261 - 302
Target Start/End: Original strand, 52776453 - 52776494
Alignment:
| Q |
261 |
acttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
52776453 |
acttctacggtacacctcataaattgaggtgtaccggtactc |
52776494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 1129126 - 1129173
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | ||||||||||||| |
|
|
| T |
1129126 |
atagggaacttctacggtaca-ctcacaaagtgaggtgtaccggtactc |
1129173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 286
Target Start/End: Original strand, 3732246 - 3732274
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3732246 |
ggaacttctacggtacacctcacaaattg |
3732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 22)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 40054997 - 40054949
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
40054997 |
atagggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
40054949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 4156187 - 4156142
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4156187 |
gggaacttctacggtacacctcacaaattggagtgtaccggtactc |
4156142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 43916346 - 43916391
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
43916346 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
43916391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 45650414 - 45650369
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
45650414 |
gggaacttctacggtatacctcacaaattgagatgtaccggtactc |
45650369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 254 - 302
Target Start/End: Original strand, 51004787 - 51004835
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
51004787 |
atagggaatttctacggtacacctcacaaattgaggtgtaccggtactc |
51004835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 23539941 - 23539988
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
23539941 |
agggaacttctacggtacacctcagaaattgaggtgtaccggtactct |
23539988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 7435921 - 7435875
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| |||||||| |
|
|
| T |
7435921 |
agggaacttctacggtacacctcacaaattgaggtgtatcggtactc |
7435875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 1845073 - 1845118
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||| |
|
|
| T |
1845073 |
gggaacttctacggtgcacctcacaaattgaggtgtaccggtactc |
1845118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 29877702 - 29877747
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||||||||||| |
|
|
| T |
29877702 |
gggaacttctacggtacacctcataaatttgggtgtaccggtactc |
29877747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 36735512 - 36735557
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
36735512 |
gggaacttctacggtacacctcataaattggagtgtaccggtactc |
36735557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 17644389 - 17644436
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
17644389 |
agggaatttctacggtacatctcacaaattgagatgtatcggtactct |
17644436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 32912211 - 32912258
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | |||| |||||||||| |
|
|
| T |
32912211 |
gggaacttctacagtacacctcacaaattgaggtgtatcggtactctc |
32912258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 310
Target Start/End: Original strand, 35873935 - 35873987
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactctctgcttc |
310 |
Q |
| |
|
||||||||||||||||||| |||||||| || |||||||||||||| |||||||| |
|
|
| T |
35873935 |
agggaacttctacggtaca-ctcacaaagtgagatgtaccggtact-tctgcttc |
35873987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 310
Target Start/End: Original strand, 38207528 - 38207581
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactctctgcttc |
310 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | |||| ||||||| |||||||| |
|
|
| T |
38207528 |
agggaacttctacggtacacctcataaattgaggtgtatcggtact-tctgcttc |
38207581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 47458934 - 47458888
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
47458934 |
gggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
47458888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 49982455 - 49982501
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | ||||||| ||||| |
|
|
| T |
49982455 |
agggaacttctacggtacacctcataaattgaggtgtaccgatactc |
49982501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 23582133 - 23582174
Alignment:
| Q |
262 |
cttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
23582133 |
cttctacggtacacctcacaaattgaggtgtaccgatactct |
23582174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 44808811 - 44808766
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||| ||||| |
|
|
| T |
44808811 |
gggaacttctacggtacatctcacaaattgaggtgtaccgatactc |
44808766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 256 - 304
Target Start/End: Original strand, 5956525 - 5956572
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
5956525 |
agggaacttctacggtacacc-cacaaattaagctgtaccggtactctc |
5956572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 12105158 - 12105205
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||| |||||||| || | |||||||||||||| |
|
|
| T |
12105158 |
tagggaacttctacggtaca-ctcacaaaatgaggtgtaccggtactct |
12105205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 12838178 - 12838130
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||| ||||||||| ||||| || | |||||||||||||| |
|
|
| T |
12838178 |
tagggaacttctaaggtacacctaacaaaatgaggtgtaccggtactct |
12838130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Complemental strand, 41568852 - 41568804
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
41568852 |
tagggagcttctacggtacacctcacaaatttaggtgtaccgatactct |
41568804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 17)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 45690499 - 45690546
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
45690499 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactctc |
45690546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 8333890 - 8333936
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
8333890 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
8333936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 38073106 - 38073152
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
38073106 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactct |
38073152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 302
Target Start/End: Original strand, 41555430 - 41555476
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
41555430 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
41555476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 38030557 - 38030602
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
38030557 |
gggaacttctacgatacacctcacaaattggggtgtaccggtactc |
38030602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 11088633 - 11088586
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
11088633 |
agggaacttctacggtacacctcacaaattgaggtgtaccagtactct |
11088586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 258 - 303
Target Start/End: Complemental strand, 9221200 - 9221155
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
9221200 |
ggaacttttacggtacacctcataaattgggatgtaccgatactct |
9221155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 34188941 - 34188896
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
34188941 |
gggaacttctacggtacaccttacaaattgaggtgtaccggtactc |
34188896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 291
Target Start/End: Complemental strand, 5819723 - 5819687
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5819723 |
tagggaacttctacggtacacctcacaaattgagatg |
5819687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 2859358 - 2859405
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||| |||| |||||| | |||||||||||||| |
|
|
| T |
2859358 |
agggaacttctacggtacatctcataaattgaggtgtaccggtactct |
2859405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 258 - 301
Target Start/End: Complemental strand, 12002750 - 12002707
Alignment:
| Q |
258 |
ggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| ||||||| |
|
|
| T |
12002750 |
ggaacttctacggtacacctcacaaattgaggtgtatcggtact |
12002707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 12182966 - 12182919
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||| ||||| || | |||||||||||||| |
|
|
| T |
12182966 |
agggaacttctacggtacacctaacaaaatgaggtgtaccggtactct |
12182919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Original strand, 28318040 - 28318087
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
28318040 |
agggagcttctacggtacacctcacaaattgaggtgtaccgatactct |
28318087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 37781866 - 37781912
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| ||||||| |
|
|
| T |
37781866 |
gggaacttctacggtacacctcacaaattgaggtgtacatgtactct |
37781912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 257 - 303
Target Start/End: Original strand, 42640850 - 42640896
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | |||||||||||| |
|
|
| T |
42640850 |
gggaacttctacggcacacctcacaaattgaggtataccggtactct |
42640896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 15362469 - 15362514
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||| | |||||| | ||||||||||||| |
|
|
| T |
15362469 |
gggaacttctacggtacaccttataaattgaggtgtaccggtactc |
15362514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 254 - 302
Target Start/End: Complemental strand, 9589523 - 9589476
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | ||||||||||||| |
|
|
| T |
9589523 |
atagggaacttctacggtaca-ctcacaaaatgaggtgtaccggtactc |
9589476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 10966031 - 10965985
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
10966031 |
agggaacttctacggtacacctcacaaattgaggtgtaccggtactc |
10965985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 19474078 - 19474032
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
19474078 |
gggaacttctacggtacacctcacaaattgaggtgtaccggtactct |
19474032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 302
Target Start/End: Complemental strand, 14508032 - 14507982
Alignment:
| Q |
252 |
acatagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
14508032 |
acattgggaacttctacggtacacctcataaattgaggtgtaccggtactc |
14507982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 1706012 - 1705967
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
1706012 |
gggaacttctacggtacacctcataaattgaggtgtaccggtactc |
1705967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 10887809 - 10887854
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
10887809 |
gggaacttctacggtacacctcataaattgaggtgtaccggtactc |
10887854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 259 - 304
Target Start/End: Complemental strand, 16893302 - 16893257
Alignment:
| Q |
259 |
gaacttctacggtacacctcacaaattgggatgtaccggtactctc |
304 |
Q |
| |
|
||||||||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
16893302 |
gaacttctatggtacacctcacaaattgaggtgtaccggtactctc |
16893257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 255 - 310
Target Start/End: Complemental strand, 1339781 - 1339727
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactctctgcttc |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||| ||||| |||||||| |
|
|
| T |
1339781 |
tagggaacttctacggtacacgtcacaaattgaggtgtaccagtact-tctgcttc |
1339727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6295785 - 6295738
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
6295785 |
agggagcttctacggtacacctcacaaattgaggtgtatcggtactct |
6295738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 256 - 303
Target Start/End: Complemental strand, 6302595 - 6302548
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
6302595 |
agggagcttctacggtacacctcacaaattgaggtgtatcggtactct |
6302548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 255 - 302
Target Start/End: Complemental strand, 21294198 - 21294151
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
21294198 |
tagggaactcctacggtacacctcataaattgaggtgtaccggtactc |
21294151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 302
Target Start/End: Complemental strand, 24249213 - 24249167
Alignment:
| Q |
256 |
agggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||| |||||||| |
|
|
| T |
24249213 |
agggaacttctacggtacaccttacaaattgaggtgtatcggtactc |
24249167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Original strand, 2994322 - 2994367
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||| |||||||||| |||||| | ||||||||||||| |
|
|
| T |
2994322 |
gggaacttctacagtacacctcataaattgaggtgtaccggtactc |
2994367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 303
Target Start/End: Original strand, 14872332 - 14872373
Alignment:
| Q |
262 |
cttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
14872332 |
cttctacggtacacctcacaaattgaggtgtaccgatactct |
14872373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 311
Target Start/End: Complemental strand, 23416906 - 23416851
Alignment:
| Q |
254 |
atagggaacttctacggtacacctcacaaattgggatgtaccggtactctctgcttct |
311 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | ||||||||||||| |||||||| |
|
|
| T |
23416906 |
atagggaacttctacggtaca-ctcacaaaatgaggtgtaccggtactc-ctgcttct |
23416851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 303
Target Start/End: Original strand, 229817 - 229857
Alignment:
| Q |
263 |
ttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||| |
|
|
| T |
229817 |
ttctacggtacacctcacaaattgaggtgtaccgatactct |
229857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 255 - 303
Target Start/End: Original strand, 24151122 - 24151170
Alignment:
| Q |
255 |
tagggaacttctacggtacacctcacaaattgggatgtaccggtactct |
303 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | |||| || |||||| |
|
|
| T |
24151122 |
tagggagcttctacggtacacctcacaaattgaggtgtatcgatactct |
24151170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0271 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0271
Description:
Target: scaffold0271; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 17067 - 17022
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
17067 |
gggaacttctacggtacacctcacaaattgaggtgtaccgatactc |
17022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 302
Target Start/End: Complemental strand, 214546 - 214501
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtactc |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
214546 |
gggaacttctacggtacacctcataaattgaattgtaccggtactc |
214501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 257 - 301
Target Start/End: Complemental strand, 11059 - 11015
Alignment:
| Q |
257 |
gggaacttctacggtacacctcacaaattgggatgtaccggtact |
301 |
Q |
| |
|
|||||||||| ||||||||||||||||||| | ||||||| |||| |
|
|
| T |
11059 |
gggaacttctgcggtacacctcacaaattgaggtgtaccgatact |
11015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University