View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_103 (Length: 268)
Name: NF11788_low_103
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 2508455 - 2508221
Alignment:
| Q |
17 |
agaggaaaacaagtccaaggtagtggtgattgattctttgcaatcgtgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaaagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508455 |
agaggaaaacaagtccaaggtagtggtgattgattctttgcaatcatgggagtttcatgtcaaccaagcttctaatcagaattctcctgtaagtcaaagt |
2508356 |
T |
|
| Q |
117 |
ttgaatgtttttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttcttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2508355 |
ttgaatgtttttgaagcttcaaacgagtatttgatttgtgaattttctagttttgattcaaattgatttgctggttcaggttgtgttgttctttttcttt |
2508256 |
T |
|
| Q |
217 |
aaggattgagtattattggattgattgatagatat |
251 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||| |
|
|
| T |
2508255 |
aagggtagagtattattggattgattgatagatat |
2508221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University