View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_108 (Length: 253)
Name: NF11788_low_108
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 2009206 - 2009445
Alignment:
| Q |
1 |
caagtctattattgctgccagtttgtgcataatgtaacatattattgctgccaaaacaagtgtaagaggacaacatttgttgaaaaccatgaaggatact |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2009206 |
caagtctattattgctgccagtttatgcataatgtaacatattattgctgccaaaacaagtgtaagaggacaacatttgttgaaaaccatgaaggatact |
2009305 |
T |
 |
| Q |
101 |
gagaagttaaacataacagcnnnnnnngctaataagatacactgttgttttcccaactaccca-gaaggctagttcatgtgtcatcagtattggatcagt |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2009306 |
gagaagttaaacataacagcaaaaaaagctaataagatacactgttgttttcccaactacccatgaaggctagttcatgtgtcatcagtattggatcagt |
2009405 |
T |
 |
| Q |
200 |
gcagcaagagatcttactggtcaatagcctacgagttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2009406 |
gcagcaagagatcttactggtcaatagcctacgagttcat |
2009445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University