View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_109 (Length: 253)
Name: NF11788_low_109
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_109 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 1820011 - 1819811
Alignment:
| Q |
14 |
gatgaatgtaaagtgcaaatgaatgatctagtgaaaagcattagacaagtgctcttgaaaccttaaagaagatgctgctaaagtgatctgtactagtgta |
113 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
1820011 |
gatgaatgcatagtgacaatgaatgatctagtgaaaagcattagacaagtgctcttgaaaccttgaagaaga---tgctaaagtgatctgtactagtgta |
1819915 |
T |
 |
| Q |
114 |
tcaaatnnnnnnnnnncaagttctattctgtggaatttcatgttttgaat--tagtctcttttttagtgttgatttag--tttgtttcattgttgatctt |
209 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||||||||||| ||| ||||||||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
1819914 |
tcaaat-aaaaaaaaacaagttctattgtgtgaaatttcatgttttgaattataggctcttttttagtgttaatttagtttttgtttcattattgatctt |
1819816 |
T |
 |
| Q |
210 |
ctaat |
214 |
Q |
| |
|
||||| |
|
|
| T |
1819815 |
ctaat |
1819811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 73
Target Start/End: Complemental strand, 1840457 - 1840417
Alignment:
| Q |
33 |
tgaatgatctagtgaaaagcattagacaagtgctcttgaaa |
73 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1840457 |
tgaatgatctagtgaaaagcattaggaaagtgctattgaaa |
1840417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University