View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_110 (Length: 251)
Name: NF11788_low_110
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_110 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 10 - 236
Target Start/End: Original strand, 45952167 - 45952403
Alignment:
| Q |
10 |
agtgagatgaatactagtagaggtatatataggacaaggagaccctcaatctctctacatttttgttatttgcatggacaaacattcacacatgacaacc |
109 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45952167 |
agtgacatcaatagtagtagaggtatatataggacaaggagaccctcaatctctctacatttttgttatttgcatggacaaacattcacacatgacaacc |
45952266 |
T |
|
| Q |
110 |
gatgtatagtcaataatggtgattggaaaccaatgctttgtagaaatggccctcactc---------ctcacattatgtttgaagac-aattattcttct |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
45952267 |
gatgtatagtcaataacggtgattggaaaccaatgctttgtagaaatggccctcactcctcacatttctcacattatgtttgaagacaaattattcttct |
45952366 |
T |
|
| Q |
200 |
ttttgctgaagctagcaccacccgtatgagttaaatc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45952367 |
ttttgctgaagctagcaccacccgtatgagttaaatc |
45952403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University