View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_124 (Length: 236)
Name: NF11788_low_124
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_124 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 5111061 - 5111243
Alignment:
| Q |
15 |
atgaaaagaacaaattaaccaagtttaaaaataatatttgtcatttttaagtttatattatgccaaaataataacgaactattttagtatttaaagcaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5111061 |
atgaaaagaacaaattaaccaagtttaaaaataatatttgtcatttttaagtttatattatgacaaaataataacgaactattttagtatttaaagcaca |
5111160 |
T |
 |
| Q |
115 |
atttctttnnnnnnntgaatggattcgttaaaattcgaaactnnnnnnntctttgaacttgagcatc---atctcctagcccta |
195 |
Q |
| |
|
|| ||||| ||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
5111161 |
atgtctttaaaaaattgaatggat-cgttaaaattcgaaactataaaaatctttgaacttgagcatcatcatctcctagcccta |
5111243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University