View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_125 (Length: 236)
Name: NF11788_low_125
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_125 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 71 - 113
Target Start/End: Complemental strand, 13354713 - 13354671
Alignment:
| Q |
71 |
aaactgatctcacatgcatgtttaagttttatttttaacttca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13354713 |
aaactgatctcacatgcatgtttaagttttatttttaacttca |
13354671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 113
Target Start/End: Complemental strand, 13361266 - 13361213
Alignment:
| Q |
60 |
aaaagaaagataaactgatctcacatgcatgtttaagttttatttttaacttca |
113 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
13361266 |
aaaagaaagataaatcgatctcacatgcatgtttaaattatatttttaacttca |
13361213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 113
Target Start/End: Complemental strand, 13354670 - 13354626
Alignment:
| Q |
69 |
ataaactgatctcacatgcatgtttaagttttatttttaacttca |
113 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13354670 |
ataagctgatttcacatgcatgtttaagttttatttttaacttca |
13354626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University