View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_129 (Length: 234)
Name: NF11788_low_129
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_129 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 17108431 - 17108640
Alignment:
| Q |
1 |
aattatttatgtcgcattgtcagacaataattctttaggtaaatgtttgcccaattcgtcggataattgtcttttgaatgttttcttggtctctcttaac |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17108431 |
aattacttatgtcgcattgtcagacaataattcttcaggtaaatgtttgcccaattcgtcggataactgtcttttgaatgttttcttggtctctcttaac |
17108530 |
T |
 |
| Q |
101 |
gatcgataaatgtgttgtcatctctgttgtttggaagatgctttctcttccttatattaagttcaatacagatgactctttgattgataatatgggggct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17108531 |
catcgataaatgtgttgtcatctctgttgtttagaagatgctttcttttccttatattaagttgaatacagatgactctttggttgataatatgggggct |
17108630 |
T |
 |
| Q |
201 |
tgtggcggga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
17108631 |
tgtggcggga |
17108640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University