View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_135 (Length: 220)
Name: NF11788_low_135
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_135 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 119 - 220
Target Start/End: Original strand, 2008858 - 2008959
Alignment:
| Q |
119 |
tattttatttctatttatatgatctaattgtgaatggcctgataattttctgattctatcataacttccgtgccgtataatgatgatcaggtgaacaaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2008858 |
tattttatttctatttatatgatctaattgtgaatggcctgataattttctgattctatcataacttccatgccgtataatgatgatcaggtgaacaaat |
2008957 |
T |
|
| Q |
219 |
aa |
220 |
Q |
| |
|
|| |
|
|
| T |
2008958 |
aa |
2008959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 2008818 - 2008858
Alignment:
| Q |
1 |
gcatacaattttcatttctaaaaggattctcggtacatcct |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2008818 |
gcatacaattttcatttctaaaaggattctcggtacatcct |
2008858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University