View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_47 (Length: 432)
Name: NF11788_low_47
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35266484 - 35266275
Alignment:
| Q |
1 |
gagcaggattgagatgattattatcaagttgaagaacagctttaacggagctccgacggagaatcgccggcgtcaatctacggttgcaccgcttggtatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266484 |
gagcaggattgagatgattattatcaagttgaagaacagctttaacggagctccgacggagaatcgccggcgtcaatctacggttgcaccgcttggtatt |
35266385 |
T |
|
| Q |
101 |
acggcggaatggagcgaagtctacgaacaagtgacggttaccgattgtatcggagagacgtagcacttgagaaagagaaaccgatgacaccgtgttcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266384 |
acggcggaatggagcgaagtctacgaacaagtgacggttaccgattgtatcggagagacgtagcacttgagaaagagaaaccgatgacaccgtgttcagc |
35266285 |
T |
|
| Q |
201 |
gccatcgccc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35266284 |
gccatcgccc |
35266275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 279 - 418
Target Start/End: Complemental strand, 35266202 - 35266063
Alignment:
| Q |
279 |
taaaaggaagaagaggtcacaaagtacttaattcatatacaccaccaacttctcattccttttcaatcttcatcttgaacttgtgaaagtgctagtctca |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35266202 |
taaaaggaagaagaggtcacaaagtacttaattcatatacaccaccaacttctcattccttttcaatcttcatcttgaacttgtgaaagtgctagtctca |
35266103 |
T |
|
| Q |
379 |
ctgggtttttgtttgatgtgatgtggtctatggttatacg |
418 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35266102 |
ctgggtttttgtttgatgtggtgtggtctatggttatacg |
35266063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University