View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_56 (Length: 398)
Name: NF11788_low_56
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 20 - 391
Target Start/End: Complemental strand, 43490056 - 43489685
Alignment:
| Q |
20 |
caaagccaaactcaatttccctgaaaatgttacacttcgtaaccctccaccagctactactactactcaatggaacgtttcgaattcaccgagttcgatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43490056 |
caaagccaaactcaatttccctgaaaatgttacacttcgtaaccctccaccagctactactactactcaatggaacgtttcgaattcaccgagttcgatt |
43489957 |
T |
 |
| Q |
120 |
gtttctattacaacttctactgatcctgttgttcatactagaccttttcctaactcttctcagcattcgacaaacttttatgatcgttttcagttttcgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43489956 |
gtttctattacaacttctactgatcctgttgttcatactagaccttttcctaactcttctcagcattcgacaaacttttatgatcgttttcagttttcgg |
43489857 |
T |
 |
| Q |
220 |
gtattcctgctccaaggaatatttatgatgataatgtgattagggcttcttctgtggcttctcatctacaatcttcatcatcgtcgccagcttcttcttt |
319 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43489856 |
gtattcctcctgcaaggaatgtttatgatgataatgtgattagggcttcttctatggcttctcatctacaatcttcatcatcgtcgccagcttcttcttt |
43489757 |
T |
 |
| Q |
320 |
gtcatcatcttcttctgcatttgtttcttctatgcagggcaatacttcagtttcctcgtatttttcttctca |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43489756 |
gtcatcatcttcttctgcatttgtttcttctatgcagggcaatacttcagtttcctcgtatttttctactca |
43489685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University