View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_65 (Length: 369)
Name: NF11788_low_65
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_65 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 199 - 369
Target Start/End: Original strand, 27326732 - 27326902
Alignment:
| Q |
199 |
tgtttgccaaaacgagagtttcatgctgtcattcttaaaaattcatcgttactccaatgatctaccatagacggttactatcaagtctctgaatgtgtag |
298 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27326732 |
tgtttgccaaaacgagagtttcacgttgttattcttaaaatttcatcgtcaatccaatgatctaccatagacggttactatcaagtctccgaatgtgtag |
27326831 |
T |
 |
| Q |
299 |
tctagtcgtgtgagttgatatgtttaacgagtattaagaaggaggttcatagttcaatccttgttattatt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27326832 |
tctagtcgtgtgagttgatatgtttaactagtattaagaaggaggttcatagttcaatccttgttattatt |
27326902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 17 - 177
Target Start/End: Original strand, 27326481 - 27326640
Alignment:
| Q |
17 |
acaatcgacttttcccagctcatatcttccaatcctaaggaacgttccatggcaatccaaaaacttggcgatgcttgccgcgattggggtttctttatgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27326481 |
acaatcgacttttcccagctcatatcttccaatcctatggaacgttccatggcaatccaaaaacttggcaatgcttgccgcgattggggtttctttatgg |
27326580 |
T |
 |
| Q |
117 |
tacaaatatttaaactcaaataatgtatacttttacatttattttggacagtatatatttt |
177 |
Q |
| |
|
|||||||||||||||| ||||| | ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
27326581 |
tacaaatatttaaactaaaatagtatatacttttacattt-ttttggaccgtatatatttt |
27326640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University