View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_78 (Length: 334)
Name: NF11788_low_78
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_78 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 17 - 319
Target Start/End: Original strand, 45952091 - 45952403
Alignment:
| Q |
17 |
tgaagcttcctaatcagttgatcactcttattatggattgtatcaagtcaataaaaatctattgtgggaagtggcaagtgacatcaatactagtagaggt |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45952091 |
tgaagcttcctaatcagttgataactcttattatggattgtatcaagtcaataaaaatctattgtgggaagtggcaagtgacatcaatagtagtagaggt |
45952190 |
T |
 |
| Q |
117 |
atatataggacaaggagaccctcaatctctctacatttttgttatttgcatggacaaacattcacacatgacaaccgatgtatagtcaataatggtgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45952191 |
atatataggacaaggagaccctcaatctctctacatttttgttatttgcatggacaaacattcacacatgacaaccgatgtatagtcaataacggtgatt |
45952290 |
T |
 |
| Q |
217 |
ggaaaccaatgctttgtagaaatggccctcactc---------ctcacattatgtttgaagac-aattattcttctttttgctgaagctagcaccacccg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45952291 |
ggaaaccaatgctttgtagaaatggccctcactcctcacatttctcacattatgtttgaagacaaattattcttctttttgctgaagctagcaccacccg |
45952390 |
T |
 |
| Q |
307 |
tatgagttaaatc |
319 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45952391 |
tatgagttaaatc |
45952403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University