View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11788_low_85 (Length: 319)
Name: NF11788_low_85
Description: NF11788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11788_low_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 24885830 - 24886130
Alignment:
| Q |
1 |
aatagagtttcagttattcgccctaaggcgtgaagatcccatcgcgagttgcagttcttccttacatgtcagatggtgatgtagtagttggtagctatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885830 |
aatagagtttcagttattcgccctaaggcgtgaagatcccatcacgagttgcagttcttccttgcatgtcagatggtgatgtagtagttggtagctatca |
24885929 |
T |
 |
| Q |
101 |
tacttcgtatcaatatcttggtaacaaaaaattcgcctttaaggattatttaatattaattgtttatggattagaaaattaatattttcacttgaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24885930 |
tacttcgtatcaatatcttggtaataaaaaatatgcctttgaggattatttaatattaattgtttatggattagaaaattaatattttcacttgaagagt |
24886029 |
T |
 |
| Q |
201 |
aatttatggatagagatagtagcaaattggttgatagttaaattggcatcaccgtcaattttttaaggttagaaggaaaattgtattttgtgcctcaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24886030 |
aatttatggatagagatagtagcaaattggttgatagttaaattagcatcaccgtcaattttttaaggttagaaggaaaattgtattgtgtgcctcaaaa |
24886129 |
T |
 |
| Q |
301 |
t |
301 |
Q |
| |
|
| |
|
|
| T |
24886130 |
t |
24886130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University