View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11789_low_13 (Length: 296)

Name: NF11789_low_13
Description: NF11789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11789_low_13
NF11789_low_13
[»] chr4 (1 HSPs)
chr4 (37-277)||(47112709-47112949)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 37 - 277
Target Start/End: Complemental strand, 47112949 - 47112709
Alignment:
37 tataaaaactaatgacaaataattttttatcaatagacctaaaactatgattttagtaaccttactcttgaaccgatctgacacttttggagagagcttg 136  Q
    |||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
47112949 tataaaaattaatgacaaataattttttatcagtagacctaaaacaatgattttagtaaccttactctcgaaccgatctgacacttttggagagagcttg 47112850  T
137 tcaactcttatgccctaaggctttattgctggcaagaacgaatatgagcttcgagcattggagctgctatatatcaaatgcagatttgaagacttgattt 236  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
47112849 tcaactcttatggcctaaggctttattgctggcaagaacgaatatgagcttcgagaattggagctgctatatatcaaatgcagatttgaagacttgattt 47112750  T
237 aaaatttgttactatgctctatctagtttgagtaggatatt 277  Q
    |||||||||||||||||||||||||||||||||||||||||    
47112749 aaaatttgttactatgctctatctagtttgagtaggatatt 47112709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University