View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11790_high_10 (Length: 215)

Name: NF11790_high_10
Description: NF11790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11790_high_10
NF11790_high_10
[»] chr8 (1 HSPs)
chr8 (159-202)||(40360459-40360502)


Alignment Details
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 40360502 - 40360459
Alignment:
159 ggaagatttttataccaaggatctccgagtttcagaatttattg 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
40360502 ggaagatttttataccaaggatctccgagtttcagaatttattg 40360459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University