View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11790_low_11 (Length: 246)
Name: NF11790_low_11
Description: NF11790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11790_low_11 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0001 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 6 - 246
Target Start/End: Original strand, 417184 - 417424
Alignment:
| Q |
6 |
agagagaagaaatcctggtttgaggaatcatcctattgaagctgcaccacaatcatctgtgatgaatcttccacctttgtaccataatccactttgtcat |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
417184 |
agagacaagaaatcctggtttgaggaatcatcctattgaagctgcaccacaatcatctgtgatgaatcttccacctttgtaccataaaccactttgtcat |
417283 |
T |
|
| Q |
106 |
gaattagaaaggattcagaaaatagtaagtttctgctctactcattgctatgagaatagttatttagatttgatatcttacattcatttaatgataactg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
417284 |
gaattagaaaggattcagaaaatagtaagtttctgctctactcattgctatgagaatagttatttagatttgatatcttacattcctttaatgataactg |
417383 |
T |
|
| Q |
206 |
ctatattatcccattgttggagcagagattactgctgaaat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
417384 |
ctatattatcccattgttggagcagagattactgctgaaat |
417424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University