View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11790_low_12 (Length: 229)
Name: NF11790_low_12
Description: NF11790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11790_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 45683878 - 45684101
Alignment:
| Q |
1 |
ctttaaggctgcttcagacttcaagaatgcttgtatagcggcggtgagtttagaaaatattaaacaagttggttttgcatctgaataaattaggatagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683878 |
ctttaaggctgcttcagacttcaagaatgcttgtatagcggcggtgagtttagaaaatattaaacaagttggttttgcatctgaataaattaggatagaa |
45683977 |
T |
|
| Q |
101 |
catgcatatttgaccctcactgcgacctttttctgaaaattacc-aaaccgaagggtatatgtaattctagtatatgtaatgagtctggctttttcaata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683978 |
catgcatatttgaccctcactgcgacctttttctgaaaattaccaaaaccgaagggtatatgtaattctagtatatgtaatgagtctggctttttcaata |
45684077 |
T |
|
| Q |
200 |
atgaatttccaaacctgatgtttt |
223 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
45684078 |
atgaattaccaaacctgatgtttt |
45684101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University