View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11791_high_16 (Length: 238)

Name: NF11791_high_16
Description: NF11791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11791_high_16
NF11791_high_16
[»] chr5 (1 HSPs)
chr5 (14-222)||(5674064-5674273)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 5674064 - 5674273
Alignment:
14 tctcgctgtgaaggtggatcaatggaagaaagtgctttatcttcgaattcgtgggtgggtggcgggt-agaggtttttaatgaatggacgaagacacctt 112  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||||||||||||    
5674064 tctcgctgtgaaggtggatcaatggaagaaattgctttatcttcgaatttatgggtgggtggcgggtgagaggtttttaatgaatggacgaagacacctt 5674163  T
113 gattgatggtggtgtgttacccctataagggcttggcgccttaccttgtgaatcgattgttatcaagcggattgggcctttggttggtcttgagcaactg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5674164 gattgatggtggtgtgttacccctataagggcttggcgccttaccttgtgaatcgattgttatcaagcggattgggcctttggttggtcttgagcaattg 5674263  T
213 gcatagtatg 222  Q
    ||||||||||    
5674264 gcatagtatg 5674273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University