View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11791_low_12 (Length: 287)
Name: NF11791_low_12
Description: NF11791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11791_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 5950642 - 5950916
Alignment:
| Q |
1 |
aataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccatggtgccagcgatatccatttgatatgtcatcagctctattgactgcaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5950642 |
aataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccagggtgccagcgatatccatttgatatgtcatcaactctattgactgcaccc |
5950741 |
T |
|
| Q |
101 |
gacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtctggataactgttcgtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5950742 |
gacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtcttgataactgttcgtcc |
5950841 |
T |
|
| Q |
201 |
tatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950842 |
tatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaatttgtgatgtcca |
5950916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University