View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11791_low_19 (Length: 238)
Name: NF11791_low_19
Description: NF11791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11791_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 5674064 - 5674273
Alignment:
| Q |
14 |
tctcgctgtgaaggtggatcaatggaagaaagtgctttatcttcgaattcgtgggtgggtggcgggt-agaggtttttaatgaatggacgaagacacctt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5674064 |
tctcgctgtgaaggtggatcaatggaagaaattgctttatcttcgaatttatgggtgggtggcgggtgagaggtttttaatgaatggacgaagacacctt |
5674163 |
T |
|
| Q |
113 |
gattgatggtggtgtgttacccctataagggcttggcgccttaccttgtgaatcgattgttatcaagcggattgggcctttggttggtcttgagcaactg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5674164 |
gattgatggtggtgtgttacccctataagggcttggcgccttaccttgtgaatcgattgttatcaagcggattgggcctttggttggtcttgagcaattg |
5674263 |
T |
|
| Q |
213 |
gcatagtatg |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
5674264 |
gcatagtatg |
5674273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University