View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11792_high_2 (Length: 331)
Name: NF11792_high_2
Description: NF11792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11792_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 29551978 - 29551860
Alignment:
| Q |
10 |
atgacatgtaacatctaccaaacttgagtgccttgcattgctcaacaattaatacaatttgaagatgacaattggtagacaaacttaacagaacaatggt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29551978 |
atgacatgtaacatctaccaaacttgagtgccttgcattgctcaaaaattaatacaatttgaagatgacaattggtagacaaacttaacagaacaatggt |
29551879 |
T |
 |
| Q |
110 |
ttggtacatattagtataa |
128 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
29551878 |
ttggtacatattagtataa |
29551860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 29551760 - 29551713
Alignment:
| Q |
267 |
catgcatgtttttctaagcatatatgcagtttgatgtcgtatttattt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29551760 |
catgcatgtttttctaagcatatatgcaatttgatgtcgtatttattt |
29551713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University