View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11793_low_27 (Length: 334)
Name: NF11793_low_27
Description: NF11793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11793_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 2e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 145 - 320
Target Start/End: Complemental strand, 42743941 - 42743775
Alignment:
| Q |
145 |
ggcataatccttatactcactaagatgtaaaattttactactactcatcatttaggaatatattctataaataaagggtattgtttaaaataaagtaaga |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42743941 |
ggcataatccttatactcactaagatgtaaatttttactactactcatcatttaggaatatattctctaaataaagggtattgtttaaaataaagtaaga |
42743842 |
T |
 |
| Q |
245 |
accttatattatatttatataaagaaaatgagttaggtcaatcgtgtgtatatttactctcttttttgtgtgtctg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
42743841 |
accttatattatatttatataaagaaaatgagtt---------gggtgtatatttactctcttttttgtgtgtctg |
42743775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University