View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11793_low_35 (Length: 259)
Name: NF11793_low_35
Description: NF11793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11793_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 4 - 247
Target Start/End: Complemental strand, 25894727 - 25894484
Alignment:
| Q |
4 |
gcagataccttgttatgaactactttagcacttttatccgtggtatcctaaatttgtggtttgttttccttgtgtattttatatacctgcagatatcccg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25894727 |
gcagataccttgttatgaactactttagcacttttatccatggtatcctaaatttgtggtttgttttccttgtgtattttatatacctgcagatatcccg |
25894628 |
T |
 |
| Q |
104 |
atttaaagcctcctagttcaccatctcctaatgcaccaactacatcaatatccacatcttctgtgggtgaggtggccaagattgaggaagaatcaagtaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25894627 |
atttaaagcctcctagttcaccatctcctaatgcaccaactacatcaatatccacatcttctgtgggtgaggtggccaagattgaggaagaatcaagtaa |
25894528 |
T |
 |
| Q |
204 |
tggcccagctcaactttcagtggaagataccccaaaggatgatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25894527 |
tggcccagctcaactttcagtggaagataccccaaaggatgatg |
25894484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 97 - 149
Target Start/End: Complemental strand, 25893543 - 25893491
Alignment:
| Q |
97 |
tatcccgatttaaagcctcctagttcaccatctcctaatgcaccaactacatc |
149 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25893543 |
tatcctgatttaaagcctcctagttcaccatctcctaatgcaccaaatacatc |
25893491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 152 - 247
Target Start/End: Complemental strand, 25893416 - 25893321
Alignment:
| Q |
152 |
tatccacatcttctgtgggtgaggtggccaagattgaggaagaatcaagtaatggcccagctcaactttcagtggaagataccccaaaggatgatg |
247 |
Q |
| |
|
||||||| |||||||||||||||||| |||| ||||| | || |||||| ||||| ||||| ||||| || ||||||||||| |||||||| |||| |
|
|
| T |
25893416 |
tatccacttcttctgtgggtgaggtgcccaatattgatgcagtatcaagcaatggaccagcccaactctccgtggaagatacaccaaaggaggatg |
25893321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 25893458 - 25893422
Alignment:
| Q |
152 |
tatccacatcttctgtgggtgaggtggccaagattga |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25893458 |
tatccacatcttctgtgggtgaggtgcccaatattga |
25893422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University