View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11793_low_36 (Length: 254)
Name: NF11793_low_36
Description: NF11793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11793_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 38482492 - 38482736
Alignment:
| Q |
1 |
agggtgttggttccatccatcattgtttgggaattagattaggcttagtcggcattggatgcagttagttgcagttaacacctcggatccgtccaatcaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38482492 |
agggtgttggttccatctatcattgtttgggaattagattaggcttcgtcggcattggatgcagttagttgcagttaacacctcggatccatccaatcaa |
38482591 |
T |
 |
| Q |
101 |
gatcagacagtttagatctaaaattctgaaattaaaatctagatcgtgtgatcttcatttgacggcctaaactcattgattacatgattgtatcaatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38482592 |
gatcagacagtttagatctaaaattctgaaattaaaatctagatcgtgtgatcttcatttggcggcctaaactcattgattacatgattgtatcaatttt |
38482691 |
T |
 |
| Q |
201 |
tgactgcattaaacatgatcctattgtttgtatttactctctgtg |
245 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38482692 |
tgactgcatcaaacatgatcctattgtttgtgtttactctctgtg |
38482736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University