View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11793_low_39 (Length: 248)
Name: NF11793_low_39
Description: NF11793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11793_low_39 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 5242135 - 5242367
Alignment:
| Q |
10 |
caaaggcaaaggtttgattttatgctatttagtgtaggactagtagtagtagtatataacaatgtctttttcttttggtcgtgaaaagtgaaaaaggata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242135 |
caaaggcaaaggtttgattttatgctatttagtgtagga------gtagtagtatataacaatgtctttttcttttggtcgtgaaaagtgaaaaaggata |
5242228 |
T |
 |
| Q |
110 |
aaatggtctttgaaaggtgtaaataaagaaatgaataatttagtgcgcacgaagcaagaaaggcagaagagtttcacaaaagtccagggaaaccccacga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242229 |
aaatggtctttgaaaggtgtaaataaagaaatgaataatttagtgcgcacgaagcaagaaaggcagaagagtttcacaaaagtccagggaaaccccacga |
5242328 |
T |
 |
| Q |
210 |
gggtgtgtgaatgtgaatgaatgaactaaaggtgctgcc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5242329 |
gggtgtgtgaatgtgaatgaatgaactaaaggtgctgcc |
5242367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University