View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11794_high_24 (Length: 322)
Name: NF11794_high_24
Description: NF11794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11794_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 44547125 - 44546958
Alignment:
| Q |
1 |
tctgaaccatttggtctcgatccaacggttaccgatgggctgactggaagcaatggcattcgaatagatagtacatacacatcataaaagaaagataaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44547125 |
tctgaaccatttggtctcgatccaacggttaccgatgggctgactggaagcaatgacattcga----atagtacatacacatcataaaagaaagataaaa |
44547030 |
T |
 |
| Q |
101 |
tgtggactattagnnnnnnnnnnnnttgacaaatataagattgcatattaccaagctttccacattaattat |
172 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547029 |
tgtggactattagaaaaaagaaaaattgacaaatttaagattgcatattaccaagctttccacattaattat |
44546958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 237 - 303
Target Start/End: Complemental strand, 44546893 - 44546827
Alignment:
| Q |
237 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttcttttctggaatcttta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546893 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttcttttctggaatcttta |
44546827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University