View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11794_high_27 (Length: 250)
Name: NF11794_high_27
Description: NF11794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11794_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 12 - 144
Target Start/End: Original strand, 1553372 - 1553496
Alignment:
| Q |
12 |
attgagtaaaactagtttgtttcccaaattttaaaaatatcacacataaatggttagaattatgagtttcaccgacnnnnnnnnntaatgttgaaaaaat |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1553372 |
attgagtaaaactagtttatttcccaaatttaaaaaatatcacacataaatggttagaattatgagtttcaccgacaa--------aatgttgaaaaaat |
1553463 |
T |
 |
| Q |
112 |
atagggtaaactttatctatttttatgtaatta |
144 |
Q |
| |
|
||| |||||||||||||||||||||||| |||| |
|
|
| T |
1553464 |
atacggtaaactttatctatttttatgttatta |
1553496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 173
Target Start/End: Complemental strand, 1537558 - 1537392
Alignment:
| Q |
12 |
attgagtaaaactagtttgtt----tcccaaattttaaaaatatcacacataaatggttagaattatgagtttcaccgacnnnnnnnnntaatgtt-gaa |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||| ||| | ||||| || |
|
|
| T |
1537558 |
attgagtaaaactagtttgttaatttcccaaattttaaaaatatcacacataaattatgagaattatgagtttcattgacaaaaagaattcatgttaaaa |
1537459 |
T |
 |
| Q |
107 |
aaaatatagggtaaactttatctatttttatgtaattaactcttaaatgttgactcacatattactt |
173 |
Q |
| |
|
||||| || |||||||| |||||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
1537458 |
aaaatgtaaagtaaacttgatctatttttatgtaagtaactcttaaatgttgaaccacataatactt |
1537392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University