View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11794_high_31 (Length: 238)
Name: NF11794_high_31
Description: NF11794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11794_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 47212833 - 47213051
Alignment:
| Q |
1 |
tttttccttgtccctgagacaaagaatgtccctattgaagagatgacacaaagagtgtggaagcagcattggttttggaagaggtttgttgaaaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212833 |
tttttccttgtccctgagacaaagaatgtccctattgaagagatgacacaaagagtgtggaagcagcattggttttggaagaggtttgttgaaaatgatt |
47212932 |
T |
 |
| Q |
101 |
atattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctcagttgtaaattaaaggaatttctagtactaagttgttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212933 |
atattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctcagttgtaaattaaaggaatttctagtactaagttgttttg |
47213032 |
T |
 |
| Q |
201 |
tcaaataaatgcatggtta |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47213033 |
tcaaataaatgcatggtta |
47213051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University