View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11794_low_35 (Length: 203)

Name: NF11794_low_35
Description: NF11794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11794_low_35
NF11794_low_35
[»] chr1 (1 HSPs)
chr1 (30-184)||(47212897-47213051)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 30 - 184
Target Start/End: Original strand, 47212897 - 47213051
Alignment:
30 agcataggttttggaagaggtttgttgaaaatgattatattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctcagtt 129  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47212897 agcattggttttggaagaggtttgttgaaaatgattatattgaagatgagaaagtaactggtggaaattcccctagcagaaatgatcttgtttctcagtt 47212996  T
130 gtaaattaaaggaatttctagtactaagttgttttgtcaaataaatgcatggtta 184  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47212997 gtaaattaaaggaatttctagtactaagttgttttgtcaaataaatgcatggtta 47213051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University