View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11795_low_10 (Length: 292)
Name: NF11795_low_10
Description: NF11795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11795_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 278
Target Start/End: Complemental strand, 4204743 - 4204466
Alignment:
| Q |
1 |
ggtctcaattctacaccacaaggacaacccctgggggttgcgctatagtgtagcagagttttaacaataagcattttttgttatccgcgattgatttcac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4204743 |
ggtctcaattctacaccaccaggacaacccctgggggttgcgctatagtgtagcagagttttaacaataagcattttttgttatccgcgattgatttcac |
4204644 |
T |
|
| Q |
101 |
cgtgtagtactttacgccgacaatgattcaaatttaaactcttgctttattagcgttcatttgttgttttatgcttatgaaatagcaagctatatgtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4204643 |
cgtgtagtactttacgccgacaatgattcaaatttaaactcttgctttattagcgttcatttgttgttttatgcttatgaaatagcaagctatatgtttg |
4204544 |
T |
|
| Q |
201 |
atgaataatattccactattcaaaatttcagttcttctgttctgtacaagttgatatactagtagtctgctgattcca |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
4204543 |
atgaataatattccattattcaaaatttcagttcttctgttctgtacaagttgatatactagtagtctgttaattcca |
4204466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University