View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11795_low_12 (Length: 243)
Name: NF11795_low_12
Description: NF11795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11795_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 3088548 - 3088331
Alignment:
| Q |
12 |
gagatgaatattataaggttgagctttcttaataaagagaaaaagtcattcaaagccagctttaattttaatattatttcagcatgttcttcgtttcttt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088548 |
gagaggaatattataaggttgagcttttttaataaacagaaaaagtcattcaaagccagctttaattttaatattatttcagcatgttcttcgtttcttt |
3088449 |
T |
 |
| Q |
112 |
gg------atttgnnnnnnnnnnnnnnnaccttaaccattttaaaattgtattttttctataaaagcataggcttagatcccttgtttttcaagcaaata |
205 |
Q |
| |
|
|| |||| |||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3088448 |
ggatttttatttttatttttatttttttaccttaactattttaaaattgtattttttctataaaagcaaaggctttgatcccttgtttttcaagcaaata |
3088349 |
T |
 |
| Q |
206 |
tatagcaacttaagtttc |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3088348 |
tatagcaacttaagtttc |
3088331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University