View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11795_low_14 (Length: 230)
Name: NF11795_low_14
Description: NF11795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11795_low_14 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 106 - 230
Target Start/End: Complemental strand, 31827529 - 31827406
Alignment:
| Q |
106 |
tgcattttgttattataaacaaattaaacttacccttgagtggattcaattatgcaatagtnnnnnnnntatgagaacaaaacaaaatttgaacttttta |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
31827529 |
tgcattttgttattataaacaatttaaacttacccttgagtggattcaattatgcaatagt-aaaaaaatatgacaacaaaacaaaatttgaacttttta |
31827431 |
T |
|
| Q |
206 |
ttttagtttaatttgtaaatatgtt |
230 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31827430 |
ttttagtttaatttgtaaatatgtt |
31827406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 31827666 - 31827569
Alignment:
| Q |
8 |
atatcaaacatcataacaaacttttatcatatgagctctgcacttatcaatgatcacgagtcatctctaattgctttacattaagagttaatcctttt |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
31827666 |
atatcaaacgtcataacaaacttttatcatatgagctctgcacttatcaatgatcacgagtcatctctacttgctttacattaagagctaatcctttt |
31827569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University