View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11798_high_6 (Length: 255)
Name: NF11798_high_6
Description: NF11798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11798_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 33608775 - 33609016
Alignment:
| Q |
1 |
attttcaattaattatttctttttatcaccatactcat--tttcaggctgcaccgttatatctatctgaaattgctcccccaaaatggcgaggcgctttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33608775 |
attttcaattaattatttctttttatcaccatactcatatttttaggctgcaccgttatatctatctgaaattgctcccccaaaatggcgaggcgctttt |
33608874 |
T |
 |
| Q |
99 |
agtaccggctttcaattctttttgggagttggtgtagtcgctgcaggctgcataaactatggcaccgccgagcacacatggggatggagactttcgcttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33608875 |
agtaccggctttcaattctttttgggagttggtgtagtcactgcaggctgcataaactatggcaccgctgagcacacatggggatggagactttcgcttg |
33608974 |
T |
 |
| Q |
199 |
gacttgcagtggttcctgcaatagtgatgacgattggttcct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33608975 |
gacttgcagtggttcctgcaatagtgatgacaattggttcct |
33609016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 43 - 240
Target Start/End: Original strand, 33617994 - 33618191
Alignment:
| Q |
43 |
aggctgcaccgttatatctatctgaaattgctcccccaaaatggcgaggcgcttttagtaccggctttcaattctttttgggagttggtgtagtcgctgc |
142 |
Q |
| |
|
||||||||||||| || |||||||||| |||||||||||||||||||||| |||||| || |||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
33617994 |
aggctgcaccgttgtacctatctgaaactgctcccccaaaatggcgaggcacttttaacacgggctttcagttcttcttgggaattggtgtagtcgctgc |
33618093 |
T |
 |
| Q |
143 |
aggctgcataaactatggcaccgccgagcacacatggggatggagactttcgcttggacttgcagtggttcctgcaatagtgatgacgattggttcct |
240 |
Q |
| |
|
|||||||||||||| | ||| ||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
33618094 |
cggctgcataaactacgccacggccaagcacacatggggatggagactctctcttggacttgcagtggttcctgcagctgtgatgacaatcggttcct |
33618191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 43 - 218
Target Start/End: Original strand, 33627209 - 33627384
Alignment:
| Q |
43 |
aggctgcaccgttatatctatctgaaattgctcccccaaaatggcgaggcgcttttagtaccggctttcaattctttttgggagttggtgtagtcgctgc |
142 |
Q |
| |
|
|||||||||| || || ||||||||||||||||| |||||||||||||||||||| || || |||||| ||||||||| ||| ||||| || ||| ||| |
|
|
| T |
33627209 |
aggctgcaccattgtacctatctgaaattgctccaccaaaatggcgaggcgctttgagcacaagctttccattctttttaggatttggtataatcgttgc |
33627308 |
T |
 |
| Q |
143 |
aggctgcataaactatggcaccgccgagcacacatggggatggagactttcgcttggacttgcagtggttcctgca |
218 |
Q |
| |
|
||| ||||||||||||||||| ||| |||| ||||||||||||||||| || |||||||||||||| || |||||| |
|
|
| T |
33627309 |
aggttgcataaactatggcactgccaagcatacatggggatggagactctctcttggacttgcagttgtgcctgca |
33627384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 33622220 - 33622378
Alignment:
| Q |
47 |
tgcaccgttatatctatctgaaattgctcccccaaaatggcgaggcgcttttagtaccggctttcaattctttttgggagttggtgtagtcgctgcaggc |
146 |
Q |
| |
|
||||||||| || ||||||||||||||| | |||||||||||||||||||| || || ||||||| ||||||||| ||| ||||| || ||||||||| |
|
|
| T |
33622220 |
tgcaccgttctacctatctgaaattgcttcaccaaaatggcgaggcgctttgagcacaggctttccattctttttaggacttggtataatcgctgcagat |
33622319 |
T |
 |
| Q |
147 |
tgcataaactatggcaccgccgagcacacatggggatggagactttcgcttggacttgcagtggt |
211 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
33622320 |
tgcataaacaatggcaccgccgagcacac------atggagactctctcttggacttgcagtggt |
33622378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University