View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11798_high_8 (Length: 204)
Name: NF11798_high_8
Description: NF11798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11798_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 24812315 - 24812140
Alignment:
| Q |
17 |
atttggttggtaaaaatggtgtgattacagttcaaggagagcaacaaaggaaactacatggaatcgcgtccaatatgatgcgattagataagcttaagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24812315 |
atttggttggtaaaaatggtgtgattacagttcaaggagagcaacaaaggaaactacatggaatcgcgtccaatatgatgcgattagataagcttaagtt |
24812216 |
T |
 |
| Q |
117 |
ccatttcatgaatgatatacaaaatgtcatgatccaaactttgagcaatttcaaaaaccaacaagtaattcatctc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24812215 |
ccatttcatgaatgatatacaaaatgtcatgatccaaactttgagcaatttcaaaaaccaacaagtaattcttctc |
24812140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University