View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11798_low_2 (Length: 465)

Name: NF11798_low_2
Description: NF11798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11798_low_2
NF11798_low_2
[»] chr1 (1 HSPs)
chr1 (361-447)||(13021652-13021737)
[»] chr5 (1 HSPs)
chr5 (264-307)||(35556397-35556440)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 9e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 361 - 447
Target Start/End: Complemental strand, 13021737 - 13021652
Alignment:
361 tgcaaaaattacttcatttgactctataatcaaatgcagtaatacaaaatgaatgcaattggaaagtgtcattcaaacttgtatcat 447  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
13021737 tgcaaaaattacttcatttgactctataatcaa-tgcagtaatacaaaatgaatgcaattggaaagtgtcattcaaacttgtatcat 13021652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 307
Target Start/End: Original strand, 35556397 - 35556440
Alignment:
264 catggtaacaaatattctaaaaatattgtttaaggaatctatta 307  Q
    |||| |||||||| |||||||||||||||||||||||| |||||    
35556397 catgttaacaaatgttctaaaaatattgtttaaggaatttatta 35556440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University