View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11798_low_8 (Length: 238)
Name: NF11798_low_8
Description: NF11798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11798_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33340303 - 33340526
Alignment:
| Q |
1 |
acgaataccgagatatgtgaaaggaacaaacatatatggattatggtttcatgtgcaaatagatgagaagcaaaaagaattt-ataggatattcaaactc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
33340303 |
acgaataccgagatatgtgaaaggaacaaacatatatggattatggtttcatgtgcaaatagatgagaagcaaaaggaattttataggatatccaaactc |
33340402 |
T |
 |
| Q |
100 |
atattagtttggagataagatatatagaaggaacacttttggttacttgtttgagcttcaaggagcatcaatctcttggtgttctaagaaacaacaagtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33340403 |
atattagtttggagataagatatatagaaggaacacttttggttacttgtttgagcttcaaggagcatcaatctcttggtgttctaagaaacaacaagtt |
33340502 |
T |
 |
| Q |
200 |
acaactttatcatcttgtgaaacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33340503 |
acaactttatcatcttgtgaaacc |
33340526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University