View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1179_low_11 (Length: 274)
Name: NF1179_low_11
Description: NF1179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1179_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 36 - 237
Target Start/End: Complemental strand, 31532639 - 31532438
Alignment:
| Q |
36 |
gtgtgttcatcaaagattcatgaatatgtggattaatctttggtgtgtgttgctctctctagggtgggagaccttgttaggttacatcattttttaaaaa |
135 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
31532639 |
gtgtgttcatcaaagattcataaatatgtggattaatctttggtgtgtgtggctctctctaggatgagagaccttgttaggttacatcatttttttaaaa |
31532540 |
T |
|
| Q |
136 |
cgttagattaatcaagcaaactaaattataaactaaatacacttgattattcctattgtgttagattagacaaccatctctgtttttatttttcactaca |
235 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532539 |
cgttagattgatcaagcaaactaaattataaactaaatacacttgattattcttattgtgttagattagacaaccatctctgtttttatttttcactaca |
31532440 |
T |
|
| Q |
236 |
tc |
237 |
Q |
| |
|
|| |
|
|
| T |
31532439 |
tc |
31532438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University