View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1179_low_12 (Length: 260)
Name: NF1179_low_12
Description: NF1179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1179_low_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 260
Target Start/End: Original strand, 45343392 - 45343622
Alignment:
| Q |
30 |
aaaatggcgtagcgtagcgcaaaaatcggaccattatgaatatggttcggtgcatgctttgtgacaaacaagtaccgaagtcattttggccagaagctgc |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45343392 |
aaaatggcgtagcggagcgcaaaaatcggaccattatgaatatggttcggtgcatgctttgtgacaaacaagtaccgaagtcattttggttagaagctgc |
45343491 |
T |
|
| Q |
130 |
aaaatggacagttcatgttctcaaccggagtcctacactgacagttaaagacaaaactccagaagagatgtggagcggaattaaacctagagttgattac |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
45343492 |
aaaatggacagttcatgttctcaatcggagtcctacactgacagttaaagacaaaactccataagagatatggagtggaattaaacctagagttgattac |
45343591 |
T |
|
| Q |
230 |
tttagagtatttgggagtctagctcatgtcc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45343592 |
tttagagtatttgggagtctagctcatgtcc |
45343622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University