View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1179_low_13 (Length: 257)
Name: NF1179_low_13
Description: NF1179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1179_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 44 - 231
Target Start/End: Original strand, 7549036 - 7549223
Alignment:
| Q |
44 |
ggcattggccatgttttgggcttgggtgtcaagaagaccatgaatatgattaattagattatcatggaattgaggatgtgcttgtctaacattcacctca |
143 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7549036 |
ggcattagccatgttttgggcttgggtgtcaagaagaccatgaatatgattaattagattatcatggaattgaggatgtgcttgtctaacattcacctca |
7549135 |
T |
 |
| Q |
144 |
ccaccattttgcaatttatgttgcaagttcttctattgatagttctcaaggaaagctagttggatctttctatgatccctctgaactt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7549136 |
ccaccattttgcaatttatgttgcaagttcttctattaatagttctcaaggaaagctagttggatctttctatgatccctctgaactt |
7549223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University