View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1179_low_14 (Length: 250)
Name: NF1179_low_14
Description: NF1179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1179_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 242
Target Start/End: Original strand, 45343736 - 45343953
Alignment:
| Q |
25 |
ttattgtcagtagagatgttagttttgaagaggataagggctggaattgggggaggactgctgaagaagtaaagcatgacatattggtatgtgaagtcac |
124 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45343736 |
ttattgttagtagagatgttagttttgaagaggataagggatggaattgggggaggaatgttgaagaagtaaagcatgacatattggtatgtgaaggcaa |
45343835 |
T |
 |
| Q |
125 |
taatgatagtgaagattccacctttgaaagtgaagaagaggttgtagaagacactgaaacaccagctgacacagttcaagaggtagaaacaatgacctca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343836 |
taatgatagtgaagattccacctttgaaagtgaagaagaggttgtagaagacactgaaacaccagctgacacagttcaagaggtagaaacaatgacctca |
45343935 |
T |
 |
| Q |
225 |
acatcaagtgtttcatct |
242 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
45343936 |
acatcaagtgattcatct |
45343953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University