View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11800_high_7 (Length: 293)

Name: NF11800_high_7
Description: NF11800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11800_high_7
NF11800_high_7
[»] chr1 (1 HSPs)
chr1 (149-293)||(32038182-32038319)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 149 - 293
Target Start/End: Original strand, 32038182 - 32038319
Alignment:
149 attttaaacatgtaacaaagttaaaaaatatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaactcatgtgtgttagtatgaaaa 248  Q
    |||||| ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
32038182 attttagacatgtaacaaagttaaa---tatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaactcatgtgagttagtatgaaaa 32038278  T
249 taaggttaacaaataacaacacactcatgtttaatgaacttgaat 293  Q
    |||||||||||||||||||||    ||||||||||||||||||||    
32038279 taaggttaacaaataacaaca----catgtttaatgaacttgaat 32038319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University