View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11800_low_8 (Length: 318)
Name: NF11800_low_8
Description: NF11800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11800_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 194 - 315
Target Start/End: Complemental strand, 9230878 - 9230757
Alignment:
| Q |
194 |
tagtctacacatagcattgggaacccttccttttgcaaaagatgaaaaaatccacgtggtcccacatggctatgctttccacgtcgtacactcgtgacat |
293 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9230878 |
tagtctatacatagcattgggaacccttccttttgcaaaagatgaaaaaatccacgtggtcccacatggctatgctttccacgtcgtacactcgtgacat |
9230779 |
T |
|
| Q |
294 |
aggccctgttccagcccctttg |
315 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9230778 |
aggccctgttccagcccctttg |
9230757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 4 - 103
Target Start/End: Complemental strand, 9231067 - 9230968
Alignment:
| Q |
4 |
aagagattggacaagtggccaaatagaaaggaaacaaatgaaatgaactaggccggtgcttaatgagggaccctttcatcaattaacatcattacagtcc |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231067 |
aagagattggacaagtggccatatagaaaggaaacaaatgaaatgaactaggccggtgcttaatgagggaccctttcatcaattaacatcattacagtcc |
9230968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University