View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11800_low_9 (Length: 293)
Name: NF11800_low_9
Description: NF11800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11800_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 149 - 293
Target Start/End: Original strand, 32038182 - 32038319
Alignment:
| Q |
149 |
attttaaacatgtaacaaagttaaaaaatatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaactcatgtgtgttagtatgaaaa |
248 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32038182 |
attttagacatgtaacaaagttaaa---tatgtgacctttttagagaaatacacttcaatatcaatcatgcaaaccaactcatgtgagttagtatgaaaa |
32038278 |
T |
 |
| Q |
249 |
taaggttaacaaataacaacacactcatgtttaatgaacttgaat |
293 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32038279 |
taaggttaacaaataacaaca----catgtttaatgaacttgaat |
32038319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University