View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11801_high_7 (Length: 408)
Name: NF11801_high_7
Description: NF11801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11801_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 9604596 - 9604395
Alignment:
| Q |
19 |
agaaagaatattgccttctcatatctgcaatacagatccaagctgttccaatgatccaagcgtgcatgcttacacacttcatgtgttgctcatggagcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
9604596 |
agaaagaatattgccttctcatatctgcaatacagatccaagctgttccaatgatccaagcgtgcatgcatacgcacttcatgtgttgctcatggagcaa |
9604497 |
T |
|
| Q |
119 |
tggaaggtcacatacttacactcaagcgttcactacatttgtttcttaatatttatcacattttggctgcaagaccgaacaaaggttttggtcaaaaata |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9604496 |
tggaaggtcacatacatacactcaagcgttcactacatttgtttcttaatatttatcacattttggct--------gaacaaaggttttggtcaaaaata |
9604405 |
T |
|
| Q |
219 |
gtgatttata |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
9604404 |
gtgatttata |
9604395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 298 - 393
Target Start/End: Complemental strand, 9604324 - 9604229
Alignment:
| Q |
298 |
gagcaaccatcatcatgtcatctttttcttgtgtaagaatttgcagcagtctcacaacacaattagagtggcatgctttacatgtgaattgatgtc |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9604324 |
gagcaaccatcatcatgtcatctttttcttgtgtaggaatttgcagcagtctcacaacacaattagagtggcatgctttacatgtgaattgatgtc |
9604229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 20 - 59
Target Start/End: Original strand, 9571580 - 9571619
Alignment:
| Q |
20 |
gaaagaatattgccttctcatatctgcaatacagatccaa |
59 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
9571580 |
gaaagaatattgccttctcatttctgcgatacagatccaa |
9571619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University