View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11801_low_14 (Length: 253)
Name: NF11801_low_14
Description: NF11801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11801_low_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 12286362 - 12286125
Alignment:
| Q |
15 |
atgaactgtgctacaaactaagtggttgatgagttcaccctagaatggaatgtttgtgataacttgatttcaattttaggcgggaaataatttttgacca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
12286362 |
atgaactgtgctacaaactaagtggttgatgagttcaccctagaatggaatgtttgtgataacttgatttcaattttaggcggaaaata-tttttgacca |
12286264 |
T |
 |
| Q |
115 |
aatttttcttgtttcctgatcaatcataaatgagtgatgtctatacttgcgacccatttaagtacgataagaatgaagatgatacatttgtatgagatag |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12286263 |
aatttttcttgtttcccgatcaatcataaatgagtgatgtctatacttgcgacccatttaagtacgataagaatgaagatgatacatttggatgagatag |
12286164 |
T |
 |
| Q |
215 |
taatggtctctttcagtttaaccaaagttcctgagttca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12286163 |
taatggtctctttcagtttaaccaaagttcctgagttca |
12286125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University